Informacije

Sinaptičko orezivanje i selektivna eliminacija tokom adolescencije

Sinaptičko orezivanje i selektivna eliminacija tokom adolescencije


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Kako dolazi do sinaptičkog orezivanja tokom pre-adolescencije, adolescencije i post-adolescencije, nakon cvetanja hiperprodukcije sinaptičkih veza do godina kasnog detinjstva, i kako u ovoj fazi razvoja mozga dolazi do „selektivne eliminacije“ sinaptičkih veza, što zavisi od aktivnosti sinapsi koje su uključene u primarne funkcije?

Takođe, zašto, kako i u kojoj meri mozak, nakon otprilike 6 godina, dobija potrebu da smanji određene sinapse?

Ažuriranje 1: šta se tačno pokreće pre i tokom adolescencije, tako da mozak dobija nagon da izvrši sinaptičko orezivanje? Znam kako se vrši sinaptičko orezivanje, međutim, veoma sam zaintrigiran specifičnim procesima koji se dešavaju, od signala koji mozak prima da to uradi, do zašto se to tačno dešava u tako ranoj fazi života


Odgovor na ovo pitanje potencijalno bi se mogao naći u "Razumevanje razvoja mozga adolescenata i njegovih implikacija za kliničara"

Zahvaljujući istraživanju Džeja Gida i njegovih kolega sa Nacionalnog instituta za mentalno zdravlje, postalo je jasno da tokom adolescentskih godina organizacija i funkcionisanje mozga prolaze kroz složene promene. Važno je da se čini da su ove promene jedinstvene za adolescentske godine, a ne samo za ostatke razvoja mozga u detinjstvu.

Promene u frontalnim režnjevima tokom adolescencije

Volumen sive materije prednjeg režnja, koji predstavlja gustu koncentraciju neurona i njihovih delova, povećava se tokom detinjstva i ne dostiže svoj vrhunac do otprilike 11. godine (devojčice) ili 12. godine (dečaci), u kom trenutku opadaju tokom druge decenije. života i u mladosti.

Pa zašto bi se volumen sive materije prednjeg režnja mogao povećati tokom detinjstva i smanjiti tokom adolescencije?

Nedavni podaci sugerišu da je, tokom detinjstva, neuronima u frontalnim režnjevima dozvoljeno da prerastu i formiraju previše tačaka komunikacije, ili sinapsi, sa drugim neuronima. Kao rezultat, povećava se količina sive materije. Kako se detinjstvo bliži kraju i adolescencija počinje, mozak prelazi iz režima prekomerne proizvodnje u režim selekcije. Početkom druge decenije života, mozak prestaje da proizvodi prekomerno sinapse u prednjim režnjevima i stavlja sinapse koje postoje na blok za seckanje. Stotine milijardi komunikacijskih tačaka biće žrtvovane tokom tinejdžerskih godina. Zadržaće se samo one koje formiraju smislene, korisne tačke kontakta. Vođeni iskustvima tinejdžera, prednji režnjevi su oblikovani i oblikovani u konfiguraciju koja će voditi pojedinca, u dobru ili zlu, kroz odrasle godine. Kako se ovaj proces rezidbe odvija, količina sive materije se smanjuje.

Promene u drugim delovima korteksa (posebno temporalnim režnjevima)

Temporalni režnjevi, koji su kritični za formiranje pamćenja, kao i za obradu slušnih informacija i sagledavanje detaljnih obrazaca i oblika, ne dostižu svoj maksimalni nivo sive materije sve do 16. do 17. godine, u kom trenutku postaju plato. Temporalni režnjevi sadrže hipokampus, strukturu koja je centralna za stvaranje autobiografskog zapisa o tome šta neko radi i šta uči.

Izvori:

  1. White, Aaron M. "Razumevanje razvoja mozga adolescenata i njegovih implikacija za kliničara." Odsek za medicinsku psihologiju, Odeljenje za psihijatriju, Medicinski centar Univerziteta Djuk, kutija 3374, Duram, NC 27710, SAD, 2009. Web. 7. februar 2016.
  2. Steinberg, Laurence. „Perspektiva socijalne neuronauke o preuzimanju rizika od adolescenata. Razvojni pregled : DR. Nacionalna medicinska biblioteka SAD, 28. mart 2008. Web. 07. februar 2016.

Poglavlje 4

Proliferacija ćelija, sinaptičko obrezivanje i mijelinizacija: Razvoj mozga se nastavlja tokom adolescencije, pri čemu se različiti regioni razvijaju različitom brzinom. Tri povezana procesa doprinose razvoju mozga u adolescenciji. Proliferacija ćelija se sastoji u prekomernoj proizvodnji neurona i njihovih međuveza sinaptičko orezivanje se sastoji u selektivnoj eliminaciji ćelija i njihovih veza koje se retko koriste mijelinizacija se sastoji u formiranju izolacionog omotača duž dužine aksona neurona. Teorije se mogu potvrditi ili opovrgnuti. Teorije koje proizilaze iz istog modela odražavaju pretpostavke karakteristične za model koji ih je generisao.
Кључни појмови: proliferacija ćelija, kortikalna siva materija, sinaptičko orezivanje, mijelinizacija, bela materija

Prefrontalni korteks: razmišljanje kao izvršni direktor: Prefrontalni korteks nastavlja da se razvija tokom adolescencije. Ova oblast mozga je odgovorna za apstraktno razmišljanje, planiranje i predviđanje posledica nečijih akcija.
Кључни појмови: prefrontalni korteks, izvršne funkcije, multitasking

Limbički sistem: preuzimanje rizika: Limbički sistem je uključen u obradu društvenih i emocionalnih informacija. Pošto se ovaj region mozga razvija ranije od prefrontalnog korteksa, on dominira izvršnim kontrolama prefrontalnog korteksa u ranoj adolescenciji, povećavajući verovatnoću donošenja rizičnih odluka.
Кључни појмови: лимбички систем


Sve je u ravnoteži: kako mozak eliminiše neželjene veze

Naš mozak sadrži milijarde neurona i još više veza između njih. Iako su ove veze, nazvane sinapse, kritične za funkciju mozga, previše njih može predstavljati problem. Mreže u mozgu su pažljivo kreirane i zahtevaju preciznu ravnotežu između neurona i veza. Međutim, mi se rađamo sa viškom neurona koji tada formiraju mnogo više veza nego što nam je zapravo potrebno. Dakle, neželjene veze moraju biti uklonjene da bi mozak imao odgovarajuću funkciju.

Uklanjanje nepotrebnih veza se dešava tokom razvoja, u kojem se dešava proces koji se naziva sinaptičko orezivanje 1 . Sinaptičko orezivanje je kao podrezivanje drveta ili sečenje zarasle žive ograde. U mozgu, ovaj proces eliminacije dovodi do dramatičnog smanjenja veza tokom adolescencije. Broj veza se na kraju stabilizuje u odraslom dobu i učvršćuje funkcionalne mreže potrebne za pravilno funkcionisanje mozga.

Ova sinaptička prefinjenost igra ulogu u normalnom funkcionisanju mozga. Studije su otkrile da mreže funkcionišu mnogo bolje kada dođe do orezivanja 3 . Defekti sinaptičkog orezivanja su povezani sa mnogim stanjima uključujući autizam i šizofreniju. Na primer, kod šizofrenije postoji višak sinaptičkog orezivanja, što dovodi do manjeg broja sinapsi od normalnog 2 . Ovo pokazuje da sinaptičko orezivanje može igrati ključnu ulogu u nastanku razvojnih uslova, naglašavajući važnost ovog procesa čak i bez ikakvog neurološkog stanja.

Da bi smanjio sinapse kako bi se postigao tačan nivo za zdrav razvoj mozga, mozak ima različite strategije da izračuna kojih veza želi da se oslobodi. Jedna od ovih strategija prati koji su neuroni ili veze aktivni, a koji neaktivni. Oni koji su aktivni primaju signal „jačanja“, govoreći vezi da ojača i preživi, ​​dok neaktivne sinapse primaju „signal za eliminaciju“ koji govori mozgu da se oslobodi te veze. Neki od signala za jačanje, kao što su proteini iz imunog sistema koji se nazivaju proteini komplementa, već su identifikovani. Međutim, signali za eliminaciju su manje proučavani od njihovih jačanja.

Da bi ispitali ove eliminacione signale, istraživači sa Harvardske medicinske škole su pogledali šta se dogodilo ako su promenili snagu veza u snopu aksona koji se zove corpus callosum, koji povezuje levu i desnu hemisferu mozga 4 . Oni su izrazili protein koji inhibira prenos između sinapsi, u stvari čineći tu vezu neaktivnom. Veštačkim izazivanjem neaktivnosti, otkrili su da je eliminisano mnogo više veza nego što je normalno, što sugeriše da je neaktivnost dovela do procesa eliminacije.

Zatim su pregledali koji su molekuli kritični u ovom procesu eliminacije. Oni su se fokusirali na tip proteina koji se zove protein tirozin kinaze jer se pokazalo da su one kritične za različite aspekte formiranja sinapsi, uključujući rast i regeneraciju aksona.

Zatim su napravili verzije ovih proteina koji nisu bili funkcionalni i eksprimirali ih u mozgu. Otkrili su da ako ometaju funkciju jednog od ovih specifičnih proteina, nazvanih JAK2, veze koje su veštački izazvane da budu neaktivne više nisu eliminisane kao što je trebalo. Ovo je pokazalo istraživačima da je ovaj protein neophodan u procesu uklanjanja neželjenih sinapsi, ukazujući na ideju da bi JAK2 mogao biti potencijalni eliminacioni signal.

Udubljujući se u ulogu JAK2, videli su da se aktivira samo u neuronima koji su bili neaktivni. Zanimljivo je da su otkrili da se aktivira samo u prisustvu drugih veza koje su aktivirane, što sugeriše da aktivne sinapse šalju signal za eliminaciju obližnjim sinapsama koje su neaktivne da bi izazvale uklanjanje.

Zatim, umesto da blokiraju JAK2, istraživači su želeli da vide šta će se dogoditi ako povećaju njegovu aktivnost. Otkrili su da je stalna aktivacija JAK2 dovela do eliminacije sinapsi, čak i ako su bile aktivne i ne bi trebalo da budu uklonjene.

Konačno, želeli su da odrede ulogu JAK2 u normalnom sinaptičkom usavršavanju koje se dešavalo tokom razvoja mozga, a ne u njihovom veštački izazvanom sistemu. Obično se veze rafinišu tokom adolescentnog perioda kod miševa, što je proces koji zavisi od neuronske aktivnosti. Kada su blokirali aktivnost JAK2, otkrili su da se normalan proces prečišćavanja nije dogodio, što je dovelo do viška veza preko corpus callosum. Ovaj nalaz je takođe primećen u drugim delovima mozga, što sugeriše da bi to mogao biti opšti eliminacioni signal u mozgu. Identifikovanje ovih eliminacionih signala je kritično jer uspostavlja put ka razumevanju procesa sinaptičkog orezivanja. Ako istraživači shvate način na koji mozak normalno eliminiše ili održava veze, mogli bi da iskoriste to znanje da razviju terapiju za stanja koja karakterišu deficiti sinaptičkog orezivanja. Na primer, mogli bi da prouče da li je JAK2 prekomerno aktiviran kod šizofrenije, što bi utvrdilo da li ovaj protein doprinosi razvoju bolesti. Na kraju, istraživači bi mogli da razviju lekove za blokiranje JAK2, u nadi da će uspostaviti ravnotežu između eliminisanja i očuvanja veza.


Najjači poznati genetski rizik od šizofrenije je dekonstruisan

Osumnjičeni gen može izazvati odbeglo sinaptičko orezivanje tokom adolescencije - studija koju finansira NIH.

Mesto u hromozomu 6 koje sadrži gen C4 uzdiže se daleko iznad drugih područja povezanih sa rizikom na genomskoj „liniji horizonta“ šizofrenije, označavajući njen najjači poznati genetski uticaj. Nova studija je prva koja objašnjava kako specifične verzije gena funkcionišu biološki kako bi prenele rizik od šizofrenije. Konzorcijum za psihijatrijsku genomiku

Verzije gena koji su povezani sa šizofrenijom mogu izazvati beskonačno orezivanje još uvek sazrele komunikacione infrastrukture tinejdžerskog mozga, otkrili su istraživači koje finansira NIH. Ljudi sa bolešću pokazuju manje takvih veza između neurona ili sinapsi. Gen se više uključio kod ljudi sa sumnjivim verzijama, koji su se suočili sa većim rizikom od razvoja poremećaja, koji karakterišu halucinacije, zablude i oštećeno razmišljanje i emocije.

„Obično, orezivanje se oslobađa viška veza koje nam više nisu potrebne, pojednostavljujući naš mozak za optimalne performanse, ali previše rezidbe može narušiti mentalne funkcije“, objasnio je dr Tomas Lener, direktor Kancelarije za koordinaciju istraživanja genomike Nacionalni institut za mentalno zdravlje NIH-a (NIMH), koji je sufinansirao studiju zajedno sa Stenli centrom za psihijatrijska istraživanja na Institutu Broad i drugim komponentama NIH-a. „To bi moglo pomoći da se objasni odloženo pojavljivanje simptoma šizofrenije u kasnoj adolescenciji/ranoj odrasloj dobi i smanjenje radnog tkiva mozga. Intervencije koje su kočile ovaj proces rezidbe koji je pošao po zlu, mogle bi se pokazati transformativnim."

Gen, nazvan C4 (komponenta komplementa 4), nalazi se u daleko najvišoj kuli na genomskoj „liniji“ šizofrenije (pogledajte grafikon ispod) od više od 100 hromozomskih mesta sa poznatim genetskim rizikom za poremećaj. Pogađajući oko 1 procenat populacije, poznato je da je šizofrenija čak 90 procenata nasledna, ali se otkrivanje kako specifični geni funkcionišu na prenošenju rizika pokazalo neuhvatljivim, do sada.

Tim naučnika predvođen doktorom Steve McCarroll-om sa Instituta Broad i Medicinske škole Harvard u Bostonu, iskoristio je statističku moć koja je data analizom genoma 65.000 ljudi, 700 postmortem mozgova i preciznosti genetskog inženjeringa miševa da otkrijte tajne najjačeg poznatog genetskog rizika od šizofrenije. Uloga C4 predstavlja najubedljiviji dokaz, do sada, koji povezuje specifične verzije gena sa biološkim procesom koji bi mogao da izazove barem neke slučajeve bolesti.

„Pošto je šizofrenija prvi put opisana pre više od jednog veka, njena osnovna biologija bila je crna kutija, delom zato što je bilo praktično nemoguće modelirati poremećaj u ćelijama ili životinjama“, rekao je Mekerol. „Ljudski genom pruža moćan novi put za ovu bolest. Razumevanje ovih genetskih efekata na rizik je način da otvorite tu blok kutiju, zavirite unutra i počnete da vidite stvarne biološke mehanizme.

McCarrollov tim, uključujući kolege sa Harvarda, Beth Stevens, Ph.D., Michael Carroll, Ph.D., i Aswin Sekar, izvještavaju o svojim nalazima na mreži 27. januara 2016. u časopisu Nature.

Dio hromozoma 6 koji obuhvata nekoliko gena za koje se zna da su uključeni u imunološku funkciju pojavio se kao najjači signal povezan sa rizikom od šizofrenije u analizama na nivou genoma od strane Konzorcijuma za psihijatrijsku genomiku koji finansira NIMH u poslednjih nekoliko godina. Ipak, konvencionalna genetika nije uspela da otkrije nijednu specifičnu verziju gena koja je povezana sa šizofrenijom.

Da bi otkrio kako sajt povezan sa imunitetom predstavlja rizik za mentalni poremećaj, Mekerolov tim je pokrenuo potragu za „kriptičnim genetskim uticajima“ koji bi mogli da generišu „nekonvencionalne signale“. C4, gen sa poznatom ulogom u imunitetu, pojavio se kao glavni osumnjičeni jer je neobično varijabilan među pojedincima. Nije neuobičajeno da ljudi imaju različit broj kopija gena i različite DNK sekvence koje dovode do toga da gen radi drugačije.

Istraživači su duboko istražili složenost toga kako se takva strukturna varijacija odnosi na nivo ekspresije gena i kako bi se to, zauzvrat, moglo odnositi na šizofreniju. Otkrili su strukturno različite verzije koje utiču na ekspresiju dva glavna oblika gena u mozgu. Što je više verzija rezultirala izražavanjem jednog od oblika, nazvanog C4A, to je više bila povezana sa šizofrenijom. Što je osoba više imala sumnjivih verzija, više je C4 uključen i veći je rizik od razvoja šizofrenije. Štaviše, u ljudskom mozgu, pokazalo se da je protein C4 najzastupljeniji u ćelijskoj mašineriji koja podržava veze između neurona.

Prilagođavajući tehnike molekularne genetike miša za proučavanje sinaptičke rezidbe i uloge C4 u imunološkoj funkciji, istraživači su takođe otkrili ranije nepoznatu ulogu C4 u razvoju mozga. Tokom kritičnih perioda postnatalnog sazrevanja mozga, C4 označava sinapsu za rezidbu tako što u nju deponuje sestrinski protein nazvan C3. Opet, što se više C4 uključuje, više sinapsi je eliminisano.

Kod ljudi se takva racionalizacija/orezivanje dešava kada se mozak razvija do pune zrelosti u kasnim tinejdžerskim godinama/ranom odraslom dobu – što upadljivo odgovara uzrastu početka simptoma šizofrenije.

Budući tretmani dizajnirani da suzbiju prekomerne nivoe rezidbe suprotstavljanjem odbeglom C4 kod rizičnih pojedinaca mogli bi da ugnječe proces koji bi inače mogao da se razvije u psihotičnu bolest, sugerišu istraživači. I zahvaljujući prednosti stečenoj u razumevanju uloge takvih proteina komplementa u imunološkoj funkciji, takvi agensi su već u razvoju, primećuju oni.


Grickanje neurona: bliži pogled na sinaptičko obrezivanje


Autor:
Kayt Sukel
Objavljeno:
27. juna 2018. godine

Više glava sinapse šalje filopodiju (zelenu) koja se konvergira na jednu mikrogliju (crvenu), što se vidi pomoću skenirajuće elektronske mikroskopije fokusiranog jonskog snopa (FIBSEM). Slika ljubaznošću L. Weinhard, EMBL (Pogledajte takođe video, ispod priče)

Decenijama, neurobiolozi su pretpostavljali da je sinaptičko orezivanje, proces eliminacije sinapsi od strane specijalizovanih ćelija zvanih mikroglija, kritičan za zdrav razvoj i funkciju mozga. Ali pošto je mikroglija mala i brza, istraživačima je bilo teško da u potpunosti razumeju gde, zašto, kada i kako mikroglija menja specifične sinapse i kako to utiče na nervnu obradu i plastičnost. Istraživači iz Evropske laboratorije za molekularnu biologiju (EMBL) u Italiji kreirali su novu tehniku ​​snimanja koja hvata mikrogliju u činu „grickanja“ delova sinapsi, nudeći nove uvide u to kako mikroglija pomaže u oblikovanju moždanih kola.

Magija mikroglije

Ljudska bića se rađaju sa obiljem sinapsi, funkcionalnim kontaktnim tačkama između moždanih ćelija. Post-mortem studije su pokazale da mozak novorođenčadi pokazuje pravi procvat sinaptičkih veza kako oni ulaze u detinjstvo. Broj tih veza će dramatično pasti tokom adolescencije, a istraživači smatraju da je ovaj proces rezidbe ključan za zdrav razvoj mozga. Kada proces krene naopako, to može dovesti do onesposobljavajućih neurorazvojnih poremećaja kao što je šizofrenija, kao i neurodegeneracije kasnije u životu (pogledajte „Praćenje neuroinflamacije u razvoju, neurodegenerativna bolest“).

Marie-Ive Tremblay, neuronaučnik sa kanadskog univerziteta Laval, kaže da sada postoje značajni dokazi da mikroglija, male, specijalizovane imune ćelije, igraju ključnu ulogu u ovim procesima rezidbe. „Mikroglije su imune ćelije koje igraju važnu ulogu u održavanju zdravlja mozga. Sada shvatamo da su oni super aktivni u zdravom mozgu, pomažući da se poboljšaju važna kola", kaže ona. „U protekloj deceniji videli smo da igraju ključnu ulogu u razvoju - ali iu zrelom mozgu. Oni su sada povezani sa plastičnošću, učenjem i pamćenjem. Zato je veoma važno da razumemo njihovu fiziološku ulogu koliko god možemo, u sinaptičkom orezivanju i u drugim ulogama."

Iako postoje teorije o sinaptičkom orezivanju i kako mikroglija može uticati na razvoj mozga uklanjanjem određenih veza i jačanjem drugih, neki istraživači smatraju da nedostaje jakih dokaza koji bi podržali te tvrdnje.

„Ovo je ideja koja je prisutna u literaturi već duže vreme. Ali stvarni dokazi nisu toliko jaki“, kaže Edvard Bulmor, razvojni neuronaučnik sa Univerziteta u Kembridžu. „Delimično, to je zato što nemamo dobar slikovni marker sinaptičkog obrezivanja. Priča o sinaptičkom orezivanju zaista počiva na postmortem podacima. Imamo alate koji nam mogu pokazati dokaze da je sinaptička gustina abnormalna, ali to nije sasvim isto kao da možete reći da imate dokaz da je razvojni proces sinaptičkog obrezivanja objašnjenje za to. Nedostajali su nam alati za pravilno istraživanje."

"grickanje" slika

Kornelijus Gros i njegov tim u EMBL-u nadali su se da će pronaći način da obezbede takve alate za predstavljanje onoga što on naziva „događajima u ishrani“.

„Preovlađujuća teorija je da su mikroglije bukvalno jele cele sinapse“, kaže on. „Sinapse su tako male, a mikroglija tako dinamična, da većina in vivo tehnike snimanja nisu imale vremena ili prostornu rezoluciju da vide ove stvari."

Gross i kolege su proveli veći deo pet godina da osmisle tehniku ​​snimanja koja dobro sagledava šta je mikroglija radila u ćelijama hipokampusa – prolazeći kroz dosta pokušaja i grešaka u tom procesu. Koristili su kombinaciju fluorescentne mikroskopije sa svetlosnim listovima sa korelativnom svetlosnom i elektronskom mikroskopijom (CLEM) i mogli su da vide da mikroglija ne jede cele veze, već „grize“ delove i delove na mestu kontakta. Bili su u stanju da vizualizuju da mikroglija šalje tanku projekciju zvanu filopodija da bi uspostavila kontakt sa sinapsom, pre nego što su izvršili rečeno „grickanje“. Rezultati su objavljeni u broju od 26. marta Nature Communications.

„Ovo je selektivan proces. I videli smo da sinapsa nije u potpunosti eliminisana - ostala je čak i nakon što je grickana. Dakle, mikroglija jedu, ali ne eliminišu", kaže Gross. „To znači da moramo ponovo razmisliti o teoriji o tome šta mikroglija radi kada je u pitanju remodeliranje ovih kola. Verujemo, umesto da uklanjaju sinapse, one zapravo pomažu u njihovom formiranju. Uklanjajući te delove i delove, oni ne slabe sinapse, oni prave prostor da bi omogućili formiranje novih veza."

Razumevanje procesa

Tremblaj kaže da su Grosovi nalazi veoma interesantni i da nove tehnike poput njegove nude istraživačima nove načine proučavanja funkcije mikroglije.

„Sada znamo da je mikroglija veoma heterogena. Postoje različiti podtipovi koji obavljaju više zadataka i rade različite stvari za mozak. Takođe znamo da se mnogo razlikuju tokom životnog veka i u različitim regionima mozga", kaže ona. „Važno je da postoji način da se vide različiti konteksti u kojima deluju. Pošto jačina veza određuje aktivnost kola. Ova studija je pokazala da mikroglija samo malo modifikuje sinapsu. Ali to malo može imati ogromne implikacije na celu aktivnost kola."

Gross se nada da će nastaviti da usavršava tehniku ​​kako bi mogao bolje da istraži ulogu mikroglije u razvoju mozga - i kako se ovi "grizci" mogu povezati sa razvojem neurorazvojnih poremećaja.

„Sinaptičko orezivanje, na mnogo načina, još uvek je velika misterija. Microglia se stalno kreće. Moramo da uradimo više studija gde imamo vremena i prostornu rezoluciju da vidimo šta oni zapravo rade“, kaže on. „Sada, ono što treba da saznamo je šta je to sa sinapsama koje se grickaju i onima koje ne. Šta je signal „pojedi me“ ili „nemoj me jesti“? Kada budemo mogli bolje da razumemo ove signale i logiku koja stoji iza rezidbe, imamo mogućnost da razumemo kako ove ćelije pomažu u vođenju mozga dok se razvija.


Opcije pristupa

Dobijte pun pristup časopisu za 1 godinu

Sve cene su NETO cene.
PDV će biti dodat kasnije pri odlasku.
Obračun poreza će biti finalizovan prilikom plaćanja.

Dobijte vremenski ograničen ili potpun pristup članku na ReadCube-u.

Sve cene su NETO cene.


Zaključak

Proučavanje razvoja izvršne funkcije i društvene spoznaje izvan detinjstva je nova, ali brzo evoluirajuća oblast sa primenama za medicinsku dijagnozu, obrazovanje i socijalnu politiku. Otkriće da se promene u strukturi mozga nastavljaju u adolescenciji i ranom odraslom dobu doveli su u pitanje prihvaćena gledišta i doveli su do nedavnog niza istraživanja o tome kako se kognicija može promeniti kao posledica. U ovom radu smo se fokusirali na istraživanje razvojne kognitivne neuronauke, ali bogatiji prikaz promena u učenju adolescenata, strateškog i društvenog ponašanja zahteva multidisciplinarni pristup koji prepoznaje složene interakcije između genetike, strukture mozga, fiziologije i hemije i životne sredine. . Proučavanje razvoja kognicije adolescenata korišćenjem komplementarnih in vivo metoda koje iskorišćavaju prednosti svake od njih – kao što je kombinovanje fMRI sa elektroencefalografijom (EEG) ili snimanjem difuzionog tenzora (DTI) – unutar teorijskog okvira koji se odnosi na motoričke, afektivne, društvene i perceptualne funkcije kao isprepletena obećanja koja će dodatno informisati naše razumevanje tipičnog i atipičnog ponašanja adolescenata.


Материјали и методе

Životinje i tretmani

Korišćene su 72 ženke i mužjaci miša C57BL/6 WT (divlji tip) (Harlan Ibérica, Barselona, ​​Španija), koji su izvedeni iz 17 legla. Miševi su smešteni (3-4 životinje/kavez) i držani na vodi i čvrstoj ishrani по вољи. Uslovi okoline, kao što su svetlost i mrak (12/12 h), temperatura (23°C) i vlažnost (60%), kontrolisani su za sve životinje. Sve eksperimentalne procedure na životinjama je odobrila Etička komisija za eksperimentisanje na životinjama Istraživačkog centra Principe Felipe (Valensija, Španija), u skladu sa smernicama odobrenim Direktivom Saveta Evropskih zajednica (86/609/ECC) i Španskim kraljevskim dekretom 1201/2005.

Intermitentni tretman etanolom je započet rano u adolescenciji ili tokom prepubescentnog perioda na postnatalni dan (PND) 30 (1, 19). Jutarnje doze fiziološkog rastvora ili 25% (v/v) etanola (3 g/kg) u izotoničnom fiziološkom rastvoru davane su intraperitonealno miševima starim 30 dana dva uzastopna dana sa dvodnevnim intervalima bez injekcija tokom 2 nedelje (PND30 do PND43), kao što je prethodno opisano (68, 74). Nisu zabeleženi znaci iritacije peritonealne šupljine, bol ili distres ili periferna inflamacija izazvana intraperitonealnom koncentracijom etanola, što se slaže sa drugim studijama koje su koristile intraperitonealnu primenu etanola (45). I ženke i mužjaci miševa su pokazali slične ili veće nivoe alkohola u krvi od ljudskih adolescenata intoksikiranih etanolom (76). Da bi se inhibirao mTOR put, nekim životinjama je intraperitonealno davan rapamicin (3 mg/kg LC Laboratories, Woburn, Kanada), rastvoren u 100% DMSO razblaženom na 60% (v/v) sa fiziološkim rastvorom, 1 h pre svakog etanola ili injekcija fiziološkog rastvora. Životinje su nasumično raspoređene u četiri grupe prema njihovom tretmanu: (i) fiziološki rastvor ili kontrolni (18 ženki, 18 muškaraca) (ii) rapamicin plus fiziološki rastvor (18 ženki, 18 muškaraca) (iii) etanol (18 ženki, 18 muškaraca) ) (iv) rapamicin plus etanol (18 žena, 18 muškaraca). Nisu primećene promene u telesnoj težini životinja ili u težini mozga tokom povremenog tretmana (Slika S1). Miševi su žrtvovani dislokacijom grlića materice 24 h nakon poslednje (8.) primene etanola ili fiziološkog rastvora (PND44). Nikakvi nivoi etanola u serumu nisu otkriveni 24 h nakon poslednje injekcije etanola. Neke životinje su korišćene za molekularne i dil analize bojenja (24 ženke, 24 mužjaka). Jedna hemisfera svake životinje je uklonjena i sveže isečena za Dil bojenje. Hipokampus druge hemisfere je seciran i odmah zamrznut u tečnom azotu do analize. Druge životinje (48 ženki, 48 muškaraca) korišćene su za izvođenje studija ponašanja nakon tretmana etanolom na PND46 ovim testnim dnevnim redosledom: prepoznavanje novih objekata, pasivno izbegavanje, Hebb-Vilijamsov lavirint.

Western blot analiza

Vestern blot tehnika je izvedena u lizatima tkiva hipokampusa (n = 6 uzoraka/grupi ženki ili muškaraca), kao što je opisano na drugom mestu [Montesinos et al ( 68 )]. Upotrebljena primarna antitela su: p-mTOR, p-ERK1/2 (Santa Cruz Biotechnology, Heidelberg, Nemačka), p-CREB, p-Akt (Cell Signaling Technology, Leiden, Holandija). Membrane su isprane, inkubirane sa odgovarajućim HRP-konjugovanim sekundarnim antitelima i razvijene pomoću ECL sistema (ECL Plus Thermo Fisher Scientific, Illinois, SAD). Sve membrane su skinute i inkubirane sa Coomassie blue brilliant kao kontrolom ukupnog punjenja proteina (36). Intenzitet trake je kvantifikovan pomoću softvera za analizu ImageJ 1.44p (Nacionalni instituti za zdravlje, Bethesda, MD, SAD). Analiza denzitometrije je prikazana u proizvoljnim jedinicama normalizovanim na odgovarajuće Coomassie plavo briljantno bojenje (Slika S2).

Priprema tkiva, Dil bojenje, konfokalno snimanje i analiza kičme

Mozgovi (n = 6 mozgova/grupi ženki ili muškaraca) su brzo secirani na 200 µm debljine koronalnih rezova u 4°C PB 0,1 M. Čuvani su u 1,5% PFA u PB 0,1 M rastvoru najmanje 30 minuta. Rezovi su čuvani u PB 0,1 M sa 0,05 M natrijum azidom na 4 ° C do upotrebe. Dil boja (1,1′-Dioktadecil-3,3,3′,3′-Tetrametilindokarbocijanin perhlorat („Dil“ DilC18(3)), Molecular Probes) je razblažen u N,N-dimetilformamidu (Sigma) na 5 mg/mL. Kriške su inkubirane u PBS-u koji sadrži Dil na 1:500–1:2000 osnovnog rastvora tokom 10 minuta. Zatim su kriške inkubirane u PB 0,1 M sa 0,05 M natrijum azidom preko noći (o/n) na sobnoj temperaturi da bi se omogućilo da Dil potpuno difunduje duž neuronskih membrana. Rezovi su montirani korišćenjem FluorSafe (Calbiochem, SAD i Kanada) i vizuelizovani čim se medijum osuši. Fluorescentne slike su snimljene pod Leica konfokalnim mikroskopom (model TCS-SP8-AOBS, Manhajm, Nemačka).

Kako zupčasti girus pokazuje fiziološke i anatomske razlike, u zavisnosti od nivoa koronalne studije, i upoređivanjem suprapiramidalnih i infrapiramidalnih lopatica sloja ćelija granula (4), rezovi su odabrani između Bregme -2,60 mm i Bregme -2,06 mm. Slike su se uvek snimale na suprapiramidalnom sečivu. Na osnovu njihovih migracionih obrazaca (3), ćelije granula koje se nalaze u medijalnom regionu zupčastog girusa su odabrane da bi se izbegla različita faza sazrevanja (najstarije i najmlađe granularne ćelije) spoljašnjeg i unutrašnjeg regiona zupčastog girusa. Slike kičme su snimljene oko 80–170 µm od some. Za svaku životinju je analizirano pet do dvanaest dendritskih grana iz različitih ćelija zupčastih granula. Analiza kičme je izvedena u 3D iz z-stakova pomoću poluautomatskog softvera NeuronStudio (http://research.mssm.edu/cnic/tools-ns.html), koji meri dužinu dendrita i klasifikuje bodlje u tri glavna morfološka tipa. Ovaj metod se slaže sa dobro prihvaćenim metodama klasifikacije tipa kičme (16, 39) i smatra da su bodlje pečurke najstabilnije i zrele bodlje, a zdepave i tanke bodlje nezrele i nestabilne bodlje (11). Da bi se minimizirala bilo kakva pristrasnost, sve analize su urađene slepe u odnosu na eksperimentalno stanje. Gustina je izračunata deljenjem ukupnog broja prisutnih bodlji sa dendritskom dužinom segmenta.

Testiranje ponašanja

Heb-Vilijamsov lavirint

Ovaj zadatak je korišćen zbog svojih prednosti u odnosu na druge testove jer se ne samo mogu proceniti rešavanje problema, vizuelno-prostorne sposobnosti i kognitivne performanse glodara (17, 82), već se mogu razlikovati i lako i teško učenje i, posledično, manji kognitivni deficiti ( 15, 32, 97). Motivacija za izvođenje ovog lavirinta nije zasnovana na pojačanju (tj. hrani), već na bekstvu iz stresne situacije (hladna voda), što može uticati na učenje i pamćenje (40, 69).

Lavirint korišćen u našim eksperimentima je napravljen od crne plastike i merio je 60 cm širine × 60 cm dužine × 10 cm visine. Sadržao je startnu i golovu kutiju (obe širine 14 cm × 9 cm dužine), koje su bile postavljene na dijagonalno suprotnim uglovima. Lavirint je sadržao hladnu vodu na dubini gačenja (15°C, 3,5 cm visine), dok je kutija za golove bila popunjena svežim suvim maramicama. Several maze designs were produced by fixing different arrangements of barriers to a clear plastic ceiling. This apparatus allows the cognitive process of routed learning and water-escape motivation to be measured. The followed procedure was based on that employed by ( 33 ), in which mice must navigate the maze and cross over from the wet start box to the dry goal box to escape cold water. Animals (n = 12 mice/group of females or males) underwent a 5-minute habituation period (dry sand, no barriers) on day 1 and undertook problem A on day 2 and problem D on day 3 (4 trials/day) (practice mazes). Mice were subsequently submitted to mazes 1, 5, 3, 4 and 8 on separate days on which eight trials took place. The time limit for reaching the goal box was 5 min, after which the mouse was guided to the box. The following measurements were recorded: acquisition criterion score, considered to be a task completed in less than 60 s during two consecutive sessions total latency score (the sum of the latencies in all the problem trials in each maze) latency to reach the goal during the eighth trial error scores, for which a similar total was used (where “error” was considered the act of entering the error zone as previously described ( 82 ). Following ( 91 ), mazes were defined as easy (1, 3 and 4) or difficult (5 and 8).

Novel object recognition

Mice (n = 12 mice/group of females or males) performed this test in a black open box (24 cm × 24 cm × 15 cm) using small nontoxic objects: two plastic boxes and a plastic toy. The task procedure is elsewhere described ( 62, 75 ) and consists of three phases: habituation, training session (T1) and test session (T2). During the habituation session, mice spent 5 min exploring the open-field arena where T1 and T2 were performed. During the training session, one mouse was placed in the open-field arena containing two identical sample objects placed in the middle of the testing box for 3 min. After a 1-minute retention interval, the animal was returned to the open-field arena with two objects during the test session (3 min): one object was identical to the sample and the other was novel. Object exploration was defined as the orientation of the animal's snout toward the object within a range of ≤2 cm from the object. The recognition index was calculated by measuring the discrimination index [D.I. = (tРоман − tfamiliar)/(tРоман + tfamiliar) × 100%], with “t” taken as the time that each mouse spent exploring an object.

Passive avoidance test

A step-through inhibitory avoidance apparatus for mice (Ugo Basile, Comerio-Varese, Italy) was employed for the passive avoidance test. This cage was made of Perspex sheets and divided into two compartments (15 cm × 9.5 cm × 16.5 cm each). The safe compartment was white and illuminated by a light fixture (10 W) fastened to the cage lid, whereas the “shock” compartment was dark and made of black Perspex panels. The two compartments were divided by an automatically operated sliding door at the floor level. The floor was made of 48 stainless steel bars with a 0.7 mm diameter, placed 8 mm apart. Passive avoidance tests were carried out following the procedure previously described ( 13 ). On the training day, each mouse (n = 12 mice/group of females or males) was placed in the illuminated compartment facing away from the dark compartment. After a 60-second habituation period, the door leading to the dark compartment was opened. When the animal had placed all four paws in the dark compartment, a footshock (0.5 mA, 3 s) was delivered and the animal was immediately removed from the apparatus and returned to its home cage. The time taken to enter the dark compartment (step-through latency) was recorded. Retention was tested 24 h later following the same procedure, but with no footshock. The maximum step-through latency lasted 300 s.

RNA isolation, reverse transcription and quantitative RT-PCR

Frozen hippocampus samples (100–200 mg) (n = 6 samples/group of females or males) were used for total RNA extraction. Tissue was disrupted using 1 mL of TRIzol (Sigma-Aldrich) and the total RNA fraction was extracted following the manufacturer's instructions. Next, 500 ng of total RNA were reverse-transcribed in parallel with the TaqMan MicroRNA Reverse Transcription Kit and the TaqMan Advanced miRNA cDNA Synthesis kit (ThermoFisher Scientific, USA) following the manufacturer's protocols. The expression levels of the selected miRNAs (miR-155-5p, miR-96-5p and miR-182-5p) involved in neuroinflammatory response ( 89, 96 ) were confirmed by quantitative real-time PCR (RT-qPCR) using the TaqMan universal PCR Master miX no AmpErase UNG (ThermoFisher Scientific, USA) for the endogenous control (RNAU6) and the TaqMan Fast Advanced Master Mix for the selected miRNAs assays (ThermoFisher Scientific, USA) following the manufacturer's protocols. Quantitative two-step RT-PCR (real-time reverse transcription) was performed in the Light-Cycler 480 detection system (Roche Diagnostics). Table 1 shows the TaqMan assays employed.

TaqMan assay Mature sequence Chromosome location
U6 snRNA GTGCTCGCTTCGGCAGCACATATACTAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCAAATTCGTGAAGCGTTCCATATTTT Chr.10 LOC115487555
mmu-miR-96-5p UUUGGCACUAGCACAUUUUUGCU Chr.7: 129774692 - 129774769 [-] on Build GRCm38
mmu-miR-155-5p UUAAUGCUAAUUGUGAUAGGGGU Chr.16: 84714140 - 84714204 [+] on Build GRCm38
mmu-miR-182-5p UUUGGCAAUGGUAGAACUCACACCG Chr.6: 30165918 - 30165992 [-] on Build GRCm38

Статистичка анализа

The results are reported as the mean ± SEM. All the employed statistical parameters were calculated with SPSS v24. The Western blot data were performed by a three-way (Sex, Binge Ethanol Treatment and Rapamycin Treatment) ANOVA, followed by the Bonferroni post hoc test. If the latter failed, Kruskal–Wallis nonparametric tests followed by Dunn post hoc tests were conducted. Confocal imaging and quantitative RT-PCR were analyzed with a two-way (Sex and Treatments) ANOVA, followed by the Bonferroni post hoc test. The data from the Hebb–Williams maze were analyzed by a mixed three-way ANOVA with the aforementioned three between-subject variables and one within subject variable “Maze Difficulty” at two levels (easy and difficult). Passive avoidance was analyzed by a repeated measures ANOVA with three “between” subject variables: Gender, with two levels (male and female) Binge-like Ethanol Treatment (saline and ethanol) Rapamycin Treatment, with two levels (with and without rapamycin) Days (Training and 24-hour test) as a within subject variable. The novel object recognition test data were analyzed by a mixed ANOVA with the above-cited three between variables. Bonferroni adjustment was employed for the post hoc comparisons.


Biological Origin of Schizophrenia

The risk of schizophrenia increases if a person inherits specific variants in a gene related to “synaptic pruning”—the elimination of connections between neurons—according to a study from Harvard Medical School, the Broad Institute and Boston Children’s Hospital. The findings were based on genetic analysis of nearly 65,000 people.

The study represents the first time that the origin of this psychiatric disease has been causally linked to specific gene variants and a biological process.

It also helps explain two decades-old observations: synaptic pruning is particularly active during adolescence, which is the typical period of onset for symptoms of schizophrenia, and the brains of schizophrenic patients tend to show fewer connections between neurons.

The gene, complement component 4 (C4), plays a well-known role in the immune system. It has now been shown to also play a key role in brain development and schizophrenia risk. The insight may allow future therapeutic strategies to be directed at the disorder’s roots, rather than just its symptoms.

The study, which appears online Jan. 27 in Priroda, was led by HMS researchers at the Broad Institute’s Stanley Center for Psychiatric Research and Boston Children’s. They include senior author Steven McCarroll, HMS associate professor of genetics and director of genetics for the Stanley Center Beth Stevens, HMS assistant professor of neurology at Boston Children’s and institute member at the Broad Michael Carroll, HMS professor of pediatrics at Boston Children’s and first author Aswin Sekar, an MD-PhD student at HMS.

The study has the potential to reinvigorate translational research on a debilitating disease. Schizophrenia afflicts approximately 1 percent people worldwide and is characterized by hallucinations, emotional withdrawal and a decline in cognitive function. These symptoms most frequently begin in patients when they are teenagers or young adults.

First described more than 130 years ago, schizophrenia lacks highly effective treatments and has seen few biological or medical breakthroughs over the past half-century.

In the summer of 2014, an international consortium led by researchers at the Stanley Center identified more than 100 regions in the human genome that carry risk factors for schizophrenia.

The newly published study now reports the discovery of the specific gene underlying the strongest of these risk factors and links it to a specific biological process in the brain.

“Since schizophrenia was first described over a century ago, its underlying biology has been a black box, in part because it has been virtually impossible to model the disorder in cells or animals,” said McCarroll. “The human genome is providing a powerful new way in to this disease. Understanding these genetic effects on risk is a way of prying open that black box, peering inside and starting to see actual biological mechanisms.”

“This study marks a crucial turning point in the fight against mental illness,” said Bruce Cuthbert, acting director of the National Institute of Mental Health. “Because the molecular origins of psychiatric diseases are little-understood, efforts by pharmaceutical companies to pursue new therapeutics are few and far between. This study changes the game. Thanks to this genetic breakthrough we can finally see the potential for clinical tests, early detection, new treatments and even prevention.”

The path to discovery

The discovery involved the collection of DNA from more than 100,000 people, detailed analysis of complex genetic variation in more than 65,000 human genomes, development of an innovative analytical strategy, examination of postmortem brain samples from hundreds of people and the use of animal models to show that a protein from the immune system also plays a previously unsuspected role in the brain.

Over the past five years, Stanley Center geneticists and collaborators around the world collected more than 100,000 human DNA samples from 30 different countries to locate regions of the human genome harboring genetic variants that increase the risk of schizophrenia. The strongest signal by far was on chromosome 6, in a region of DNA long associated with infectious disease. This caused some observers to suggest that schizophrenia might be triggered by an infectious agent. But researchers had no idea which of the hundreds of genes in the region was actually responsible or how it acted.

Based on analyses of the genetic data, McCarroll and Sekar focused on a region containing the C4 gene. Unlike most genes, C4 has a high degree of structural variability. Different people have different numbers of copies and different types of the gene.

McCarroll and Sekar developed a new molecular technique to characterize the C4 gene structure in human DNA samples. They also measured C4 gene activity in nearly 700 post-mortem brain samples.

They found that the C4 gene structure (DNA) could predict the C4 gene activity (RNA) in each person’s brain. They then used this information to infer C4 gene activity from genome data from 65,000 people with and without schizophrenia.

These data revealed a striking correlation. People who had particular structural forms of the C4 gene showed higher expression of that gene and, in turn, had a higher risk of developing schizophrenia.

Connecting cause and effect through neuroscience

But how exactly does C4—a protein known to mark infectious microbes for destruction by immune cells—affect the risk of schizophrenia?

Answering this question required synthesizing genetics and neurobiology.

Stevens, a recent recipient of a MacArthur Foundation “genius grant,” had found that other complement proteins in the immune system also played a role in brain development. These results came from studying an experimental model of synaptic pruning in the mouse visual system.

“This discovery enriches our understanding of the complement system in brain development and in disease, and we could not have made that leap without the genetics.”

Carroll had long studied C4 for its role in immune disease, and developed mice with different numbers of copies of C4.

The three labs set out to study the role of C4 in the brain.

They found that C4 played a key role in pruning synapses during maturation of the brain. In particular, they found that C4 was necessary for another protein—a complement component called C3—to be deposited onto synapses as a signal that the synapses should be pruned. The data also suggested that the more C4 activity an animal had, the more synapses were eliminated in its brain at a key time in development.

The findings may help explain the longstanding mystery of why the brains of people with schizophrenia tend to have a thinner cerebral cortex (the brain’s outer layer, responsible for many aspects of cognition) with fewer synapses than do brains of unaffected individuals. The work may also help explain why the onset of schizophrenia symptoms tends to occur in late adolescence.

The human brain normally undergoes widespread synapse pruning during adolescence, especially in the cerebral cortex. Excessive synaptic pruning during adolescence and early adulthood, due to increased complement (C4) activity, could lead to the cognitive symptoms seen in schizophrenia.

“Once we had the genetic findings in front of us we started thinking about the possibility that complement molecules are excessively tagging synapses in the developing brain,” Stevens said.

“This discovery enriches our understanding of the complement system in brain development and in disease, and we could not have made that leap without the genetics,” she said. “We’re far from having a treatment based on this, but it’s exciting to think that one day we might be able to turn down the pruning process in some individuals and decrease their risk.”

Opening a path toward early detection and potential therapies

Beyond providing the first insights into the biological origins of schizophrenia, the work raises the possibility that therapies might someday be developed that could turn down the level of synaptic pruning in people who show early symptoms of schizophrenia.

This would be a dramatically different approach from current medical therapies, which address only a specific symptom of schizophrenia—psychosis—rather than the disorder’s root causes, and which do not stop cognitive decline or other symptoms of the illness.

The researchers emphasize that therapies based on these findings are still years down the road. Still, the fact that much is already known about the role of complement proteins in the immune system means that researchers can tap into a wealth of existing knowledge to identify possible therapeutic approaches. For example, anticomplement drugs are already under development for treating other diseases.

“In this area of science, our dream has been to find disease mechanisms that lead to new kinds of treatments,” said McCarroll. “These results show that it is possible to go from genetic data to a new way of thinking about how a disease develops—something that has been greatly needed.”

This work was supported by the Broad Institute’s Stanley Center for Psychiatric Research and by the National Institutes of Health (grants U01MH105641, R01MH077139 and T32GM007753).


A Novel Mechanism Underlying Activity-Dependent Pruning in Postnatal Prefrontal Cortex

Adolescence is a period of refinement of brain connectivity, particularly within frontal regions, that enables the transition to adult cognitive ability and emotional function. For this reason, adolescence has been thought of as a “critical period” of prefrontal cortex (PFC) development, similar to those observed in sensory cortical regions earlier in life. During these periods, an initial overproduction of synapses is followed by experience-dependent pruning, such that inactive synapses, and the dendritic spines they are located on, are eliminated (Crews et al., 2007 Selemon, 2013). Plasticity such as long-term potentiation (LTP) or long-term depression at particular synapses is thought to be involved in selection of connections to be retained or pruned (Selemon, 2013). Neither the molecular factors that promote spine pruning during adolescence nor those that link synaptic plasticity with structural remodeling during this period are well understood.

Cell adhesion molecules are appealing candidates for regulating structural plasticity because they can trigger cytoskeletal reorganization to promote growth or collapse of neurites via intracellular signaling cascades and are often present at presynaptic or postsynaptic sites, where they may influence or be influenced by synaptic transmission. The L1 family of cell adhesion molecules is of interest in the context of pruning because polymorphisms in several L1 genes have been linked to neuropsychiatric disorders with spine abnormalities, including autism (Salyakina et al., 2011) and schizophrenia (Chen et al., 2005). L1 cell adhesion molecules are also known to interact with class 3 semaphorins (Sema3 Wright et al., 2007 Mohan et al., 2019a), a family of secreted guidance cues that induce repulsion of growing neural processes (Liu and Strittmatter, 2001) and can promote dendritic retraction. In a recent study, Mohan et al. (2019b) examined how Close Homolog of L1 (CHL1) affects dendritic spine dynamics in cortical regions during adolescence, and whether dendritic remodeling at this time is mediated by CHL1-Sema3 interactions.

To begin with, Mohan et al. (2019b) examined spine density in PFC and primary visual cortex of juvenile and adult CHL1-null mice, and found increased density of apical, but not basal, dendritic spines relative to control mice in both regions. This suggests that CHL1 negatively regulates spine number in postnatal development. The CHL1-null mice also had a smaller proportion of more mature mushroom or stubby spines and larger proportions of immature, thin spines compared with controls. Because increases in activity are thought to drive maturation of thin spines into mushroom spines, that CHL1 deficiency predominately led to an increase in number of thin spines indicates that CHL1 likely plays a role in elimination of less active synapses on apical dendrites.

Next, the authors assayed involvement of Sema3s in CHL1-mediated pruning by treating cultured cortical neurons with Sema3 proteins. In wild-type mice, Sema3B and 3F decreased dendritic spine density, whereas other Sema3s had no effect. Sema3B failed to reduce spine density in cultures from CHL1-null mice, whereas Sema3F reduced spine density to a similar extent as in wild-type mice, suggesting that CHL1 promotes elimination of dendritic spines through interaction with Sema3B. Previous work demonstrated that Sema3F-mediated dendritic spine retraction involves an interaction with NrCAM (Mohan et al., 2019a), another L1 family member, indicating that Sema3B and Sema3F influence dendritic spines through formation of distinct receptor complexes. Strikingly, although most spines expressed either CHL1 or NrCAM, the molecules were rarely expressed in the same spine. Furthermore, Sema3B led to a selective reduction in the density of CHL1-positive spines, whereas Sema3F selectively decreased NrCAM-positive spines. Collectively, these findings show that different Sema3s induce pruning of distinct populations of spines.

Increased spine number in CHL1-null mice was accompanied by increased numbers of excitatory synapses detected with electron microscopy, so Mohan et al. (2019b) examined whether corresponding changes in synaptic transmission were observed. Miniature EPSC amplitudes were skewed toward a larger magnitude in CHL1-null mice and there was a greater variance in the total charge which reflects changes in mEPSC amplitude and time course. A uniform change in mEPSC amplitude may not have been observed in CHL1-null mice because the increase in spines was only present in apical dendrites, although the recordings sampled from both apical and basal synaptic sites. Nevertheless, these results raise the possibility that CHL1 regulates excitatory synaptic strength in a subset of PFC pyramidal cells. Decreased paired-pulse facilitation was also observed in CHL1-null mice, suggesting that CHL1 affects presynaptic function through an as-of-yet unknown mechanism.

To better understand how CHL1 modifies synaptic function, coimmunoprecipitation experiments in synaptoneurosomes enriched with both presynaptic and postsynaptic components were conducted to identify proteins associating with CHL1. Interactions with several Plexins and Neuropilins, which have been shown to act as Sema3 coreceptors with L1 cell adhesion molecules (Wright et al., 2007 Mohan et al., 2019a), were probed but CHL1 coimmunoprecipitated only with Neuropilin-2 and PlexinA4 in cortical neurons. Both Neuropilin-2, which can also be a Sema3F coreceptor with NrCAM, and PlexinA4 play a role in AMPA receptor trafficking and could influence synaptic strength when in complex with CHL1 (Yamashita et al., 2014 Wang et al., 2017).

Finally, the authors asked whether CHL1/Sema3B-mediated spine elimination might occur in an activity-dependent manner. Indeed, when cortical neuron cultures were treated with a GABA antagonist to induce an increase in neural activity, elevated Sema3B secretion was observed.

Although it has been speculated that cell adhesion receptors and diffusible molecules that guide connectivity during early development are involved in synaptic remodeling in adolescent PFC, few of the precise molecular players that drive adolescent pruning have been identified. Here, Mohan et al. (2019b) identify interactions between CHL1 and Sema3B as a novel mechanism by which immature or unneeded synapses may be selectively pruned during postnatal remodeling of PFC circuitry. Their findings indicate that CHL1/Sema3B-mediated pruning is likely to occur in an activity-dependent manner, but how spines are selected for elimination by this mechanism, and also the circumstances under which Sema3B is secreted in response to activity require further examination.

Deficiency in CHL1 led to a selective increase in thin dendritic spine number, suggesting that CHL1-Sema3B signaling promotes pruning of immature or unneeded synapses. Neuropilin-2, which was found to be part of CHL1 holoreceptor complex in cortical neurons, may play role in targeting weak connections for removal. Neuropilin-2 is downregulated following induction of LTP through a mechanism involving microRNA-188 (Lee et al., 2012). Because Neuropilin-2 acts as a coreceptor for Sema3B/F, its removal from the receptor complex might spare potentiated synapses from Sema3-mediated pruning, whereas high Neuropilin-2 expression in spines would mediate elimination of weak synaptic connections (Fig. 1). Thus, one possibility is that induction of LTP protects active connections from Sema3-mediated pruning. Conversely, it will be of interest to determine whether induction of depression in less-active spines enhances expression of Neuropilin-2 and other CHL1 holoreceptor components to promote spine elimination. Changes in synaptic strength are thought to precede spine loss or retention (Selemon, 2013), so past work showing that Neuropilin-2 and PlexinA4 can promote reduced AMPA receptor surface localization (Yamashita et al., 2014 Wang et al., 2017) could also indicate that CHL1 holoreceptor expression in spines contributes to pruning by downregulating synaptic strength before spine elimination initiated by Sema3B.

Potential mechanisms by which L1-Sema3 and β1-integrin may interact during remodeling of synaptic connectivity in the adolescent PFC. High levels of activity at potentiated synapses are associated with spine stabilization via a β1-integrin signaling, whereas downregulation of Neuropilin-2 expression via an induction of microRNA-188 may inhibit CHL1-Sema3B signaling. Less-active synapses are subject to elimination by the CHL1-Sema3B mechanism, which also may inhibit β1-integrin-mediated stabilization.

Both CHL1 and NrCAM form complexes with Neuropilin-2 but appear to be affected by different Sema3s, so it will be important to determine how certain spines come to express CHL1 versus NrCAM and are thus subject to different forms of Sema3-mediated elimination. It is possible that different types of L1/Sema3-mediated spine elimination play a role in activity-dependent competition between different local excitatory and/or afferent connections, such as inputs from the amygdala and hippocampus (Cunningham et al., 2002 Caballero et al., 2016), which are also refined during adolescence. To test this hypothesis, experiments that determine whether select afferent or local populations of neurons express Sema3B versus 3F will be needed.

L1-Sema3 signaling is likely one of several mechanisms involved in activity-dependent synaptic refinement in adolescent PFC. Indeed, another paper recently published in JNeurosci found that β1-integrin, an extracellular matrix adhesion molecule, is involved in spine stabilization or retention in the adolescent orbitofrontal cortex (DePoy et al., 2019). Selective knock-down of β1-integrin before adolescence led to a reduction in dendritic spine number and deficits in expectancy updating, a key cognitive function mediated by the OFC. β1-integrin, which is expressed throughout postnatal frontal cortex (Shapiro et al., 2017), contributes to induction of LTP (Chan et al., 2006 Babayan et al., 2012), suggesting a parallel link between dendritic spine dynamics and synaptic plasticity with β1-integrin supporting retention of active, potentiated connections, and the L1-Sema3 interactions promoting removal of less active or depressed synapses. Notably, in earlier work, Mohan et al. (2019a) found that NrCAM-Sema3F-mediated activation of Neuropilin-2 led to decreased β1-integrin expression at the synapse via Plexin activity, suggesting that these two mechanisms could work together to determine which connections are stabilized and which undergo pruning (Fig. 1).

Although Mohan et al. (2019b) found that Sema3B was secreted in response to a widespread, experimentally induced increase in neural activity in culture, it will be important to determine in what situations Sema3s are secreted in intact circuits and in response to experience. One possibility is that release of Sema3B by recently potentiated synapses drives elimination of less active neighboring spines expressing CHL1 receptor complexes. Alternatively, CHL1 holoreceptor expression at inactive or depressed synapses could render them vulnerable to Sema3B-mediated removal upon more general increases in network activity. Activity-dependent Sema3B secretion may play an on-demand role in refining excitatory connectivity in adolescent PFC, such that increased activity initiates CHL1/Sema3B-mediated pruning to limit unneeded inputs. This would not only prevent hyperexcitability, but also promote efficient and precise neural communication in mature PFC networks. Given that this type of functional refinement is thought to support cognitive maturation during adolescence, and that deficiency in CHL1 impairs cognitive functions mediated by PFC (Kolata et al., 2008), CHL1/Sema3B-mediated pruning of spines may be a novel mechanism supporting PFC-dependent adolescent cognitive development. Thus, studies by Mohan et al. (2019a,b) are a valuable step toward understanding the molecular specifiers that link synaptic remodeling with development of adult PFC function.


Подршка информације

S1 Text

S1 Fig

A) First, positive (synapses) and negative (non-synapses) examples were manually labeled in 20 images in the new sample s. B) Second, the classifier (trained on images from all other samples, excluding s) was applied to the labeled data for s and the threshold τ that yielded a recall of 50% with precision > 80% was selected. C) Third, the classifier was applied to all images in s Користећи τ as the classifier threshold.

S2 Fig

To control for variability in synapse density in different areas in the barrel, 4 regions of the barrel were imaged. Tissue was placed on a mesh copper grid. White circles depict electron beam residue after images were taken. Approximately 240 images per animal (60 images x 4 regions) were taken covering a total of 6,000μm 2 of tissue per animal.

S3 Fig

Constant rates (red) prune an equal percentage of existing connections in each pruning interval. Decreasing rates (blue) prune aggressively early-on and then slower later. Increasing rates (black) are the opposite of decreasing rates. Ending rates only prune edges in the final iteration. A) Number of edges remaining after each pruning interval. B) Percentage of edges pruned in each pruning interval. ovde, n = 1000.

S4 Fig

S5 Fig

Adjusted pruning rate per volume of tissue plotted using A) the raw data (where each point corresponds to a single animal) and B) the binned data (where each point averages over animals from a 2-day window).